Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
Hsa_circ_0000673 | |||
Gene | RSL1D1 | Organism | Human |
Genome Locus | chr16:11940357-11940700:- | Build | hg19 |
Disease | Gastric Cancer | ICD-10 | Stomach, Malignant neoplasm of unspecified (C16.9) |
DBLink | Link to database | PMID | 30061181 |
Experimental Method | |||
Sample Type | Tissue and blood samples | Comparison | Normal gastric tissues 3 cm from the margin of resected neoplastic tissues of patients with GC were isolated and confirmed by pathological evaluation. We also collected 38 plasma samples from 14 healthy donors and 24 patients with GC |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward GTATAGGTGGAACAGTCTTAA ReverseTTATATTCCTTCTTTAGAGTTTGG | Statistics | Fold Change : Downregulated pvalue : p<0.05 |
Citation | |||
Chang, P, Wang, F, Li, Y (2018). Hsa_circ_0000673 is down-regulated in gastric cancer and inhibits the proliferation and invasion of tumor cells by targetting miR-532-5p. Biosci. Rep., 38, 5:no page given. |